Review



he staining solution (kit)  (Beyotime)


Bioz Verified Symbol Beyotime is a verified supplier
Bioz Manufacturer Symbol Beyotime manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90

    Structured Review

    Beyotime he staining solution (kit)
    He Staining Solution (Kit), supplied by Beyotime, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/he+staining+solution+(kit)/hematoxylin+and+eosin+staining+kit/pm40184249-234-99-103
    Average 90 stars, based on 1 article reviews
    he staining solution (kit) - by Bioz Stars, 2026-09
    90/100 stars

    Images

    Related Articles

    H&E Stain:

    Article Title: Neurotoxicity of β-HgS differs from environmental mercury pollutants (MeHgCl and HgCl 2 ) in Neuro-2a cell.
    Article Snippet: β-HgS, differing from environmental mercury pollutants (MeHgCl and HgCl2) in chemical form, is used as traditional medicine in Asian countries for thousands of years.. In this study, Neuro-2a cells were exposed to β-HgS, MeHgCl and HgCl2 (5 μM) for 6–24 h. The cell viability of β-HgS was higher than MeHgCl with 25.9% and 72.4% in 12 h and 24 h respectively.. As the incubation time increased, MeHgCl had obvious damage to cell morphology, decreased the ratio of Bcl-2 and Bak and increased the expressions of TNF-α, IL-6 and IL-1β significantly.

    Staining:

    Article Title: Baicalein inhibits the Th1 / Th17-mediated inflammatory response by targeting STAT1/3 in EAE mice
    Article Snippet: Pertussis toxin (PTX) (180243A1) was purchased from List Biological Laboratories (Campbell, USA). .. HRP goat anti-rabbit antibody (GB23303) was obtained from Servicebio Biotechnology Co., Ltd. Anti- uorescence quenching solution (P0126) and Page 4/22 haematoxylin eosin (HE) staining kit (C0105S) were purchased from Beyotime. .. Luxol Fast Blue myelin staining solution (LFB) (eosin method) (G3240) was purchased from Solarbio.

    Article Title: Selective, user-friendly, highly porous, efficient, and rapid (SUPER) filter for isolation and analysis of rare tumor cells.
    Article Snippet: Rapid, efficient, and selective separation of tumor cells from complex body fluids is urgently needed for clinical application of tumor-cell-based liquid biopsy.. Herein, a size-selective affinity filtration system, named selective, user-friendly, highly porous, efficient, and rapid filter (SUPER Filter), was developed for high-performance tumor cell isolation and analysis.. SUPER Filter enabled selective interaction of tumor cells with size-optimized and antibody-coated micropore walls during filtration, achieving a high efficiency of 91.0 ± 6.1% in buffer and 83.7 ± 6.4% in whole blood.

    Article Title: Exosomal DEK removes chemoradiotherapy resistance by triggering quiescence exit of breast cancer stem cells.
    Article Snippet: Tumor therapeutics often target the primary tumor bulk but fail to eradicate therapy-resistant cancer stem cells (CSCs) in quiescent state.. These can then become activated to initiate recurrence and/or metastasis beyond therapy.. Here, we identified and isolated chemoradiotherapy-resistant CSCs in quiescent state with high capacity of tumor-initiation and tumorsphere formation from three types of breast tumors in mice.

    Article Title: Bevacizumab increases cisplatin efficacy by inhibiting epithelial-mesenchymal transition via ALDH1 in cervical carcinoma.
    Article Snippet: Cervical carcinoma has the highest incidence among gynaecological cancers in developing countries where the human papillomavirus (HPV) vaccine is not yet widely used.. Cancer stem cells (CSCs) are the key factors affecting treatment efficacy and cancer prognosis.. Aldehyde dehydrogenase 1 (ALDH1) is a marker of CSCs, and its expression is closely related to chemotherapy resistance in cervical carcinoma.

    Article Title: Potential mechanism of perillaldehyde in the treatment of nonalcoholic fatty liver disease based on network pharmacology and molecular docking.
    Article Snippet: .. The hematoxylin red HE staining kit (C0105S) was obtained from Beyotime (Shanghai, China). .. 30 healthy male C57BL/6 mice (4 weeks old), each weighing 20 ± 1.5g, were provided by the Henan Experimental Animal Center.

    Article Title: Puerarin inhibits macrophage M1 polarization by combining STAT1 to reduce myocardial damage in EAM model mice.
    Article Snippet: Myocarditis is an inflammatory lesion of the myocardium that is caused by a variety of factors.. At present, treatment of symptoms remains the main clinical intervention, but it cannot reduce the myocarditis damage caused by inflammation.. M1 macrophages are thought to contribute significantly to the occurrence and development of inflammation by secreting a large number of proinflammatory factors.

    Microscopy:

    Article Title: Bevacizumab increases cisplatin efficacy by inhibiting epithelial-mesenchymal transition via ALDH1 in cervical carcinoma.
    Article Snippet: Cervical carcinoma has the highest incidence among gynaecological cancers in developing countries where the human papillomavirus (HPV) vaccine is not yet widely used.. Cancer stem cells (CSCs) are the key factors affecting treatment efficacy and cancer prognosis.. Aldehyde dehydrogenase 1 (ALDH1) is a marker of CSCs, and its expression is closely related to chemotherapy resistance in cervical carcinoma.

    other:

    Article Title: Mitochondrial fission regulates midgut muscle assembly and tick feeding capacity.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-ATP5A antibody Abcam Cat#ab195891 Anti-phospho-Histone H3 (Ser10) antibody Sigma Ca#06-570 Anti-TNT antibody This paper N/A Alexa Fluor 488-conjugated goat antimouse antibody Invitrogen Cat#A-11070 Alexa Fluor 546-conjugated goat antimouse antibody Invitrogen Cat#A-11071 Horseradish peroxidase-conjugated goat antirabbit secondary antibodies Abmart Cat#M21002 Chemicals, peptides, and recombinant proteins Trizol Sigma Cat#93289 DNA Extraction Reagent Solarbio Cat#P1012 ATP Sigma-Aldrich Cat#34369-07-08 iFluorTM 488 phalloidin Yeasen Bio 40736ES75 Rhodamine-phalloidin Yeasen Bio 40737ES75 0.25% Trypsin-EDTA Gibco C25200056 Critical commercial assays MEGAscript T7 High Yield Transcripti-on kit Thermo Fisher Cat#AMB13345 SYBR Green qPCR Master Mix Bimake Cat#B21702 5X All-In-One MasterMix Abcam Cat#G492 HE staining solution (kit) Beyotime C0105 Deposited data RNA-seq data This paper SRA:PRJNA1132509 Experimental models: Organisms/strains Haemaphysalis longicornis This paper N/A Mouse: BALB/c Jsj-lab N/A Oligonucleotides Primers for qPCR: See Table S2 Tsingke N/A dsDNM2-F, CCTCATTCTGGCG GTCACTTCA Tsingke N/A dsDNM2-R, AGGCTCCTTCAACTTGG CAATCTG Tsingke N/A dsDRP1-F, GCCGAGACCGACC GTATGAGT Tsingke N/A dsDRP1-R, TCCTGCTGCGACCGATTCAC Tsingke N/A dsOPA1-F, TCAACCTGGAGACC GAGTGGAA Tsingke N/A dsOPA1-R, AGTGCTGGACCGTGCTTCTG Tsingke N/A dsPGC1-F, CACGCAGCCTACGCCAGAG Tsingke N/A dsPGC1-R, CGCCACGGACCACGAGAG Tsingke N/A dsb-catenin-F, GTGAACCTCATCA ACTACC Tsingke N/A dsb-catenin-R, ATAGGCAAGAATCT GTAAGC Tsingke N/A dsTCF4-F, GCCAGCCGCCATCCAGTT Tsingke N/A (Continued on next page) 14 Cell Reports 44, 115505, April 22, 2025



    Similar Products

    86
    Servicebio Inc definition staining pretreatment solution from he staining kit servicebio cat no g1076
    Definition Staining Pretreatment Solution From He Staining Kit Servicebio Cat No G1076, supplied by Servicebio Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/he+staining+solution+(kit)/constant+dye+e+eosin+h+hd+hematoxylin+kit/pm42123683-252-37-45
    Average 86 stars, based on 1 article reviews
    definition staining pretreatment solution from he staining kit servicebio cat no g1076 - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    86
    Keygen Biotech he staining solutions kit
    He Staining Solutions Kit, supplied by Keygen Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/he+staining+solution+(kit)/cell+dead+kit+live+staining/pmc12936097-540-9-13
    Average 86 stars, based on 1 article reviews
    he staining solutions kit - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    86
    Applygen Technologies he stains solution kit
    He Stains Solution Kit, supplied by Applygen Technologies, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/he+staining+solution+(kit)/he+kit+solution+stains/pmc12834307-108-9-13
    Average 86 stars, based on 1 article reviews
    he stains solution kit - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    90
    Beijing Solarbio Science hematoxylin eosin (he) staining solution kit
    PT-MLT hydrogel improves inflammatory response in rats with MIRI (A) A schematic showing the SD rats study design. (B) Photograph showing the animal models of reserve line, LAD ligation, and intramyocardial injection. (C) Images of <t>HE</t> <t>staining</t> of myocardium after 5 days. (D) The levels inflammatory factors of IL-6 of SD rat serum after 3 days. (E) The levels inflammatory factors of IL-1β of SD rat serum after 3 days. (F) The levels inflammatory factors of TNF-α of SD rat serum after 3 days. (G) Immunofluorescence fluorescence staining images of IL-1β in rat myocardial tissue after 5 days. (H) Fluorescence intensity of immunofluorescence staining. ( n = 3 independent biological replicates; ∗∗∗∗ p < 0.0001, ∗∗∗ p < 0.001, ∗∗ p < 0.01, and ∗ p < 0.05).
    Hematoxylin Eosin (He) Staining Solution Kit, supplied by Beijing Solarbio Science, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/he+staining+solution+(kit)/h+e+staining+kit/pmc12271618-26-0-7
    Average 90 stars, based on 1 article reviews
    hematoxylin eosin (he) staining solution kit - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Servicebio Inc he staining solution kit
    PT-MLT hydrogel improves inflammatory response in rats with MIRI (A) A schematic showing the SD rats study design. (B) Photograph showing the animal models of reserve line, LAD ligation, and intramyocardial injection. (C) Images of <t>HE</t> <t>staining</t> of myocardium after 5 days. (D) The levels inflammatory factors of IL-6 of SD rat serum after 3 days. (E) The levels inflammatory factors of IL-1β of SD rat serum after 3 days. (F) The levels inflammatory factors of TNF-α of SD rat serum after 3 days. (G) Immunofluorescence fluorescence staining images of IL-1β in rat myocardial tissue after 5 days. (H) Fluorescence intensity of immunofluorescence staining. ( n = 3 independent biological replicates; ∗∗∗∗ p < 0.0001, ∗∗∗ p < 0.001, ∗∗ p < 0.01, and ∗ p < 0.05).
    He Staining Solution Kit, supplied by Servicebio Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/he+staining+solution+(kit)/staining+kit/pmc12150184-72-7-11
    Average 90 stars, based on 1 article reviews
    he staining solution kit - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Beijing Solarbio Science he staining solution (kit)
    PT-MLT hydrogel improves inflammatory response in rats with MIRI (A) A schematic showing the SD rats study design. (B) Photograph showing the animal models of reserve line, LAD ligation, and intramyocardial injection. (C) Images of <t>HE</t> <t>staining</t> of myocardium after 5 days. (D) The levels inflammatory factors of IL-6 of SD rat serum after 3 days. (E) The levels inflammatory factors of IL-1β of SD rat serum after 3 days. (F) The levels inflammatory factors of TNF-α of SD rat serum after 3 days. (G) Immunofluorescence fluorescence staining images of IL-1β in rat myocardial tissue after 5 days. (H) Fluorescence intensity of immunofluorescence staining. ( n = 3 independent biological replicates; ∗∗∗∗ p < 0.0001, ∗∗∗ p < 0.001, ∗∗ p < 0.01, and ∗ p < 0.05).
    He Staining Solution (Kit), supplied by Beijing Solarbio Science, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/he+staining+solution+(kit)/he+staining+solution/pm40301872-63-0-7
    Average 90 stars, based on 1 article reviews
    he staining solution (kit) - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Beyotime he staining solution (kit)
    PT-MLT hydrogel improves inflammatory response in rats with MIRI (A) A schematic showing the SD rats study design. (B) Photograph showing the animal models of reserve line, LAD ligation, and intramyocardial injection. (C) Images of <t>HE</t> <t>staining</t> of myocardium after 5 days. (D) The levels inflammatory factors of IL-6 of SD rat serum after 3 days. (E) The levels inflammatory factors of IL-1β of SD rat serum after 3 days. (F) The levels inflammatory factors of TNF-α of SD rat serum after 3 days. (G) Immunofluorescence fluorescence staining images of IL-1β in rat myocardial tissue after 5 days. (H) Fluorescence intensity of immunofluorescence staining. ( n = 3 independent biological replicates; ∗∗∗∗ p < 0.0001, ∗∗∗ p < 0.001, ∗∗ p < 0.01, and ∗ p < 0.05).
    He Staining Solution (Kit), supplied by Beyotime, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/he+staining+solution+(kit)/hematoxylin+and+eosin+staining+kit/pm40184249-234-99-103
    Average 90 stars, based on 1 article reviews
    he staining solution (kit) - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    99
    Beyotime eosin he staining kit
    PT-MLT hydrogel improves inflammatory response in rats with MIRI (A) A schematic showing the SD rats study design. (B) Photograph showing the animal models of reserve line, LAD ligation, and intramyocardial injection. (C) Images of <t>HE</t> <t>staining</t> of myocardium after 5 days. (D) The levels inflammatory factors of IL-6 of SD rat serum after 3 days. (E) The levels inflammatory factors of IL-1β of SD rat serum after 3 days. (F) The levels inflammatory factors of TNF-α of SD rat serum after 3 days. (G) Immunofluorescence fluorescence staining images of IL-1β in rat myocardial tissue after 5 days. (H) Fluorescence intensity of immunofluorescence staining. ( n = 3 independent biological replicates; ∗∗∗∗ p < 0.0001, ∗∗∗ p < 0.001, ∗∗ p < 0.01, and ∗ p < 0.05).
    Eosin He Staining Kit, supplied by Beyotime, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/he+staining+solution+(kit)/Eosin+Staining+Solution/pm39662269-73-13-17
    Average 99 stars, based on 1 article reviews
    eosin he staining kit - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    Image Search Results


    PT-MLT hydrogel improves inflammatory response in rats with MIRI (A) A schematic showing the SD rats study design. (B) Photograph showing the animal models of reserve line, LAD ligation, and intramyocardial injection. (C) Images of HE staining of myocardium after 5 days. (D) The levels inflammatory factors of IL-6 of SD rat serum after 3 days. (E) The levels inflammatory factors of IL-1β of SD rat serum after 3 days. (F) The levels inflammatory factors of TNF-α of SD rat serum after 3 days. (G) Immunofluorescence fluorescence staining images of IL-1β in rat myocardial tissue after 5 days. (H) Fluorescence intensity of immunofluorescence staining. ( n = 3 independent biological replicates; ∗∗∗∗ p < 0.0001, ∗∗∗ p < 0.001, ∗∗ p < 0.01, and ∗ p < 0.05).

    Journal: iScience

    Article Title: Reactive oxygen species-responsive hydrogel loaded with melatonin as a minimally invasive treatment for myocardial I/R injury

    doi: 10.1016/j.isci.2025.112834

    Figure Lengend Snippet: PT-MLT hydrogel improves inflammatory response in rats with MIRI (A) A schematic showing the SD rats study design. (B) Photograph showing the animal models of reserve line, LAD ligation, and intramyocardial injection. (C) Images of HE staining of myocardium after 5 days. (D) The levels inflammatory factors of IL-6 of SD rat serum after 3 days. (E) The levels inflammatory factors of IL-1β of SD rat serum after 3 days. (F) The levels inflammatory factors of TNF-α of SD rat serum after 3 days. (G) Immunofluorescence fluorescence staining images of IL-1β in rat myocardial tissue after 5 days. (H) Fluorescence intensity of immunofluorescence staining. ( n = 3 independent biological replicates; ∗∗∗∗ p < 0.0001, ∗∗∗ p < 0.001, ∗∗ p < 0.01, and ∗ p < 0.05).

    Article Snippet: Hematoxylin eosin (HE) staining solution kit , Solarbio , Cat#C0105S.

    Techniques: Ligation, Injection, Staining, Immunofluorescence, Fluorescence